Mentors/Advisors: Dr. Sara Helms Cahan and Dr. Nick Gotelli
Date Initiated: 20160324
Last date modified: 20160426
This work is licensed under a Creative Commons Attribution 4.0 International License.
Lab-acclimation at 25 C in the Gotelli lab!
Ants are reared in tupperware (22X16cm) containers
They are housed in fluon-lined(insect-a-slip) containers so that they stay inside the tupperware. We fill in the container with sand and place mealworms and honey water for them to eat!
They like living in water plugged tubes!
RO water is filled to about 1/3 of the water tube and plugged with a cotton (folded hot dog and then hamburger).
Notes:
* If we run out of honey water, buy some at the Davis center and keep the receipt to get reimbursed ( or ask for money). * Visually inspect colonies while feeding to get rid of old water tubes. Make new water tubes if they need it.
The workflow for my gene expression projects usually follows this trajectory:
There is a large discussion for how we should heat shock ectotherms: static (dunk at 1 temp) , dynamic (heating over time). I've done both.
See these refs if interested:
Pro static camp:
* Rezende EL, Castañeda LE, Santos M. 2014. Tolerance landscapes in thermal ecology. Funct Ecol 28:799–809. (double check this ref; having it here so I'll read it)
* Rezende EL, Tejedo M, Santos M. 2011. Estimating the adaptive potential of critical thermal limits: methodological problems and evolutionary implications. Functional Ecology 25:111–121.
Pro slow ramp:
* Terblanche JS, Hoffmann AA, Mitchell KA, Rako L, Roux PC le, Chown SL. 2011. Ecologically relevant measures of tolerance to potentially lethal temperatures. J Exp Biol 214:3713–3725. * Overgaard J, Kristensen TN, Sørensen JG. 2012. Validity of Thermal Ramping Assays Used to Assess Thermal Tolerance in Arthropods. PLoS ONE 7:e32758.
Automated water bath
Submerging ants in the waterbath
Static heat shock:
Notes:
Depending on organism, you might want to test out which temperature will give a loss in righting response (Knock down time)
Steps:
1) Set temperature on circulating water bath *Set temperature to internal probe of glass tube
Dynamic heat shock (ramping heat shock):
Notes:
* We used a programmable circulating water bath from polyscience: https://www.polyscience.com/products/circulating-baths/heated-circulators/integrated-heated-baths/performance-programmable-controller
* It took us a while, but we ramped the water bath to an internal thermometer at 0.1 C / min
* Glass tubes: WWR borosilicate glass tubes 16 X 150 mm ; https://us.vwr.com/store/catalog/product.jsp?product_id=4675780
Steps:
1) Place ants in glass tubes with cotton plug (so they don't escape) and let them equilibrate to stress for 5 minutes at room temperature
2) Pre-set water bath to 25 C (their rearing temperature); set up internal probe in a glass tube
3) Place glass tubes with ants in water bath
4) Start ramping protocol which incubates the tubes at 25C for 5 minutes and then slowly ramps 0.1C/min; also start timer
5) Measure knockdown time (seconds) and temperature ( degrees C); knockdown = loss of righting response, so if you flip them over, they can't get back up after 5 second
This protocol outlines how I have isolated RNA with little short cuts that speed up this process
Notes, reagents and supplies:
* I use the qiagen rneazy micro kit: https://www.qiagen.com/us/shop/sample-technologies/rna/rna-preparation/rneasy-micro-kit#orderinginformation
* Depending on how accurate you want to quantify gene expression and budget, DNAse I treatment gets rid of potential DNA that can get picked up in a qPCR experiment. It comes with the Rneazy micro kit. https://www.qiagen.com/us/shop/lab-basics/enzymes/rnase-free-dnase-set#orderinginformation
* RNases are everywhere and can rapidly degrade RNA. We use BME to inhibit RNase activity. We add 10 uL of BME per 1 mL of RLT buffer (buffer we homogenize in ) http://www.sigmaaldrich.com/catalog/product/sigma/m7154?lang=en®ion=US
* 2mL Homogenizing tubes (Sarstedt, Germany? ) : https://www.sarstedt.com/en/products/laboratory/screw-cap-micro-tubes-reaction-tubes/screw-cap-micro-tubes/product/72608/
* Bullet Blender (NExt Advance) http://www.nextadvance.com/product/bullet-blender-standard/ * 1.4 mm Zirconium silicate grinding beads (Quackenbush co., inc.) : http://www.quackco.com/qbzirc.htm * Eppendorf repeater pro: http://www.pipettesupplies.com/store/parts/repeater-pro-eppendorf/
* DONT touch the inside of the tubes
* sterilize working bench with ethanol and bleach; lay down diapers. Use RNase AWAY: https://www.thermofisher.com/order/catalog/product/10328011
Steps for RNA isolation:
1) Set up all the tubes you need for the experiment
* For each sample, I set out 3 X 1.5 mL eppendorf tubes and label them
* 1 tube for transfer ant homogenate * 1 tube for 70% ethanol * 1 tube for eluting into
Quantify RNA We have used two ways to quantify RNA: qubit and nanodrop
* Qubit protocol: https://www.thermofisher.com/order/catalog/product/Q32852
* nanodrop: http://www.nanodrop.com/
Also, double check RIN values to check your technique. You can have high RNA concentrations but your RNA can be degraded. Rin values: http://www.genomics.agilent.com/article.jsp?pageId=2181&_requestid=268830
Steps:
Notes: Everything should be done on ICE!
These steps include samples + a negative control and -multiscribe control.
| Sample ID | Treatment | Qubit/nanodrop Quantification (ng/uL) | uL sample for 50ng | nuclease free water to add | total volume |
|---|---|---|---|---|---|
| Ant1 | Heat shocked | 6.53 | 7.66 | 2.34 | 10 |
Table B for reaction set up for cDNA synthesis
| Reagent | Inital conc. | Final conc | uL to add 1rxn | 10 rxns |
|---|---|---|---|---|
| RT Buffer | 10x | 1x | 1 | 10 |
| dNTPs | 25x or 100 mM | 1x or 4 mM | .8 | 8 |
| RT Random Primers | 10x | 1x | 1 | 10 |
| Rnase inhibitor | 5000 units(or 40U/uL) | 4 units | 1 | 10 |
| RT Multiscribe | 50 U/ uL | 5 U/uL | 1 | 10 |
| nuclease free water | na | na | 3.2 | 32 |
| total | 10 | 100 |
| Gene | Primer 5'-3' | Amplicon Length (bps) |
|---|---|---|
| 18s rRNA (forward) | CTCTTTCTTGATTCGGTGGGTG | |
| 18s rRNA (reverse) | TTAGCAGGCTAGAGTCTCGTTC | 100 |
| GAPDH (forward) | TAAGATTGCCGTCTTCAGCG | |
| GAPDH (reverse) | ATGCCTTCTCGATGGTTGTG | 110 |
| β-actin (forward) | TAAGATTATCGCTCCACCCG | |
| β-actin (reverse) | CTCGTCGTATTCCTGCTTCG | 112 |
| Ef1-β (forward) | GGTTCAGATGAAGAGGAAGATG | |
| Ef1-β (reverse) | TCATCTCCCCAACTTTTCAC | 111 |
| hsp83 (forward) | AGTGCTACGAGCAATTCAGC | |
| hsp83 (reverse) | CGGATGCAGAAGTGTGATAACG | 105 |
| hsc70-4_1 (forward) | CTTAATGTCTCCGCCGTGGATAAG | |
| hsc70-4_1 (reverse) | CTCAGCTTCGTTTACCATCCTCTC | 115 |
| hsc70-4_2 (forward) | GATCAAGAGGAACACGACGATACC | |
| hsc70-4_2 (reverse) | GCTCTTTCTCCCTCATAGACTTGG | 105 |
| Bip(forward) | GGTACAGTGATAGGAATTGATCTGGG | |
| Bip(reverse) | TAAGAAGGCGTGATTCGGTTACC | 112 |
| hsc70-5 (forward) | CGTTTAGTTGGTATGCCTGC | |
| hsc70-5 (reverse) | CAGGATCTTCAAATCTCCGTCC | 100 |
| hsp60 (forward) | GTTGAAGAAGGAATCGTTCCCG | |
| hsp60 (reverse) | CGATCTTGATTCCAGTCTCCTG | 109 |
| hsp40 (forward) | GATATGGATCCCTTTGGACTCG | |
| hsp40 (reverse) | CCCTTTACAAGTATTCGGACTCG | 120 |
| l2efl_#4 (forward) | TTTCCGGAGTAAGCTCGTTC | |
| l2efl_#4 (reverse) | GACAGAAGTCTCGCATTCTTCC | 117 |
Steps:
Notes: * I load 4 uL of cDNA into 6 uL of power sybr green master mix for 10 uL reactions
* Samples are run in duplicates or triplicates
* Starting out, I like to run my amplicons on agraose gels and sanger sequence them (another good line of evidence that you're detecting 1 product in addition to the the melt curve analysis at the end of the qpcr)
* I use geneious version R6 (http://www.geneious.com/) to design primers and visualize sequences
| Reagent | Inital conc. | Final conc. | uL for 1 rxn | 10 rxn set up |
|---|---|---|---|---|
| Power sybr green | 2x | 1x | 5 | 50 |
| Forward Primer | 10 uM | 250 nM | .25 | 2.5 |
| Reverse Primer | 10 uM | 250 nM | .25 | 2.5 |
| nuclease free water | na | na | .5 | 5 |
| cDNA | 0.25 ng/ul | .1 ng/uL | 4 | na |
| Total | 10 |